View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10396_low_18 (Length: 298)
Name: NF10396_low_18
Description: NF10396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10396_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 38305480 - 38305759
Alignment:
| Q |
1 |
atataactttagtgagtgttcttcctatatgcacccaaataggagctctaagacaaggaaaggaaatccattgttatgcaaccagaagtggtctgggatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38305480 |
atataactttagtgagtgttcttcctatatgcacccaaataggagctctaagacaaggaaaggaaatccattgttatgcaaccagaagtggtctgggatt |
38305579 |
T |
 |
| Q |
101 |
aaatatttctgttggcaattctctaatagatatgtacagtaaatgtggatttctagaactcggagtgaaggtctttaatcagatgatggtaaagaatacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38305580 |
aaatatttctgttggcaattctctaatagatatgtacagtaaatgtggatttctagaactcggagtgaaggtctttaatcagatgatggtaaagaatacc |
38305679 |
T |
 |
| Q |
201 |
ataacatataatactatgatatctgcttgtggagctcatggcctaggagaaaagggtttgaaatttttcgagcaaatgaa |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38305680 |
ataacatataatactatgatatctgcttgtggagctcatggcctaggagaaaagggtttgaaattttacgagcaaatgaa |
38305759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University