View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10396_low_24 (Length: 247)
Name: NF10396_low_24
Description: NF10396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10396_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 29427360 - 29427123
Alignment:
| Q |
1 |
tcaccttacgagccgattctgtaaggttgactcagatccaacccaaattttaagaacactctcacttatttttcttttcggccatcaaattccatgcctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29427360 |
tcaccttacgagccgattctgtaaggttgagtcagatccaacccaaattttaagaacactctcacttaattttcttttcggccatcaaattccatgcctt |
29427261 |
T |
|
| Q |
101 |
tattggattctagttcacatgttcatagaataatgccccagaagtatgaatcaccttcctttcctatgtagtcagagaaaacatgttaatgccgacaact |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
29427260 |
-attggattctagatcacatgttcatagaataatgccccagaagtatgaatcaccttcctttcctatgtagtcagagagaacatgttaacgccgacaact |
29427162 |
T |
|
| Q |
201 |
ttagtttctaggtgctgtcccaaagataggtttcatctc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29427161 |
ttagtttctaggtgctgtcccaaagataggtttcatctc |
29427123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University