View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10396_low_26 (Length: 243)
Name: NF10396_low_26
Description: NF10396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10396_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 12820241 - 12820013
Alignment:
| Q |
1 |
atcttggcattatgtttaatgaaggtgtgtatttgaatggcactgtttactggttttccaatccaaataagagttttaagtatagtgagaaggattttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12820241 |
atcttggcattatgtttaatgaaggtgtgtatttgaatggcactgtttactggttttccaatccgaataagagttttaagtatagtgagaaggattttac |
12820142 |
T |
|
| Q |
101 |
tgttgaacaacttatgattatctcccttgatcttagtaccgagacatacacgcgcttgttgccccctcgtgaggttgatgaagtgccagttgttcaacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12820141 |
tgttgaacaacttatgattatctcccttgatcttagtaccgagatatacacgcgcttgctgccccctcgtgaggttgatgaagtgccagttgttcaacaa |
12820042 |
T |
|
| Q |
201 |
agtcttgctgtattaagggaccgcctttg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12820041 |
agtcttgctgtattaagggaccgcctttg |
12820013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 90 - 188
Target Start/End: Complemental strand, 19326221 - 19326123
Alignment:
| Q |
90 |
aaggattttactgttgaacaacttatgattatctcccttgatcttagtaccgagacatacacgcgcttgttgccccctcgtgaggttgatgaagtgcca |
188 |
Q |
| |
|
|||||| |||| || || ||| ||||||||||||||||||||||| |||| |||||||||| || || | ||||||||| ||||||||||||||| |
|
|
| T |
19326221 |
aaggatattaccgtcgagcaatttatgattatctcccttgatcttggtactgagacatacaagcaatttcagacccctcgtggtgttgatgaagtgcca |
19326123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 88 - 150
Target Start/End: Complemental strand, 19344813 - 19344751
Alignment:
| Q |
88 |
agaaggattttactgttgaacaacttatgattatctcccttgatcttagtaccgagacataca |
150 |
Q |
| |
|
|||||||| ||||||||| || || |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19344813 |
agaaggatattactgttgggaaatttgtgattatctcccttgatcttggtaccgagacataca |
19344751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 115 - 150
Target Start/End: Original strand, 19374626 - 19374661
Alignment:
| Q |
115 |
tgattatctcccttgatcttagtaccgagacataca |
150 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19374626 |
tgattatctcccttgatcttggtaccgagacataca |
19374661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 90 - 150
Target Start/End: Complemental strand, 24254662 - 24254602
Alignment:
| Q |
90 |
aaggattttactgttgaacaacttatgattatctcccttgatcttagtaccgagacataca |
150 |
Q |
| |
|
|||||| |||| ||||| ||| | ||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
24254662 |
aaggatattaccgttgagcaattcatgattatctcccttgatcttggtactgagacataca |
24254602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University