View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10397_low_11 (Length: 224)
Name: NF10397_low_11
Description: NF10397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10397_low_11 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] scaffold0036 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 37987065 - 37986838
Alignment:
| Q |
1 |
cttgttctaaaagaatataaaagagagagagatctcaactacccaagcataaaatgaggcattgccttgtattatatacagaaatagaaatgatacagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37987065 |
cttgttctaaaagaatataaaagagagagagatctcaactactcaagcataaaatgaggcattgccttgtattatatacagaaatagaaatgatacagct |
37986966 |
T |
|
| Q |
101 |
aattttttaatcttaacctttagataagnnnnnnnnnnnnnnnnnngttatctt----aacctatgaaacatgaatactcttcgaattaggtgtgtttcg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
37986965 |
aattttttaatcttaacctttagataagtttttttatttttgttttgttatcttaatcaacctatgaaacatgaatactcttcggattaggtttgtttcc |
37986866 |
T |
|
| Q |
197 |
gtgtcagacactcgtcggtgtccgacac |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37986865 |
gtgtcagacactcgtcggtgtccgacac |
37986838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 224
Target Start/End: Complemental strand, 41849398 - 41849354
Alignment:
| Q |
180 |
gaattaggtgtgtttcggtgtcagacactcgtcggtgtccgacac |
224 |
Q |
| |
|
|||||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
41849398 |
gaattaggcgtgtcgcggtgtcagacacgcgtcggtgtccgacac |
41849354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 224
Target Start/End: Original strand, 20157283 - 20157350
Alignment:
| Q |
157 |
cctatgaaacatgaatactcttcgaattaggtgtgtttcggtgtcagacactcgtcggtgtccgacac |
224 |
Q |
| |
|
|||||||| || | |||||| || |||||||||||| |||||||| ||||| |||||||||| ||||| |
|
|
| T |
20157283 |
cctatgaagcacggatactcctcaaattaggtgtgtctcggtgtcggacacgcgtcggtgtcggacac |
20157350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 222
Target Start/End: Complemental strand, 35715 - 35677
Alignment:
| Q |
184 |
taggtgtgtttcggtgtcagacactcgtcggtgtccgac |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
35715 |
taggtgtgtttcggtgtcagacacgcgttggtgtccgac |
35677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University