View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10397_low_6 (Length: 272)
Name: NF10397_low_6
Description: NF10397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10397_low_6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 90 - 272
Target Start/End: Complemental strand, 3285903 - 3285721
Alignment:
| Q |
90 |
tttgatagttctgttaatgctgtctcctttggttttgttgctactgctgttcttatttcaatgttcttactcatggccatttttgaaaggtttcttgcac |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3285903 |
tttgatagttctgttaatgctgtctcctttggttttgttgctactgctgttcttatttcaatgttcttactcatggccatttttgaaaggtttcttgcac |
3285804 |
T |
|
| Q |
190 |
cttcttcacaagctttgtttcctaatcttcgccggaaccgtcgtgccgttgagtctccgatcagaaaacttggtcaccaccaa |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3285803 |
cttcttcacaagctttgtttcctaatcttcgccggaaccgtcgtgccgttgagtctccgatcagaaaacttggtcaccaccaa |
3285721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University