View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10398_2 (Length: 414)
Name: NF10398_2
Description: NF10398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10398_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 290; Significance: 1e-162; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 9 - 306
Target Start/End: Original strand, 30566954 - 30567251
Alignment:
| Q |
9 |
gagatgaagaaggagaagcaaaatcaggtccaaaaagctcagatttcaacaacctattataagcctcattactcccttctttaaccggtgattggttatc |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30566954 |
gagaagaagaaggagaagcaaaatcaggtccaaaaagctcagatttcaacaacctattataagcctcattactcccttctttaaccggtgattggttatc |
30567053 |
T |
|
| Q |
109 |
gattaatccgaatgtatgcagtcttgaagatgatctgcaaggtatgaatctgtcactacacttggaggattttgatggagagggtgttgatgaaaggttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30567054 |
gattaatccgaatgtatgcagtcttgaagatgatctgcaaggtatgaatctgtcactacacttggaggattttgatggagagggtgttgatgaaaggttt |
30567153 |
T |
|
| Q |
209 |
gatatcgcacgaggcgaagcggaagaagggggtgttgatagcgtttctagacggagggaggttattgttgacatcccagccgggaggtttagacctga |
306 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30567154 |
gatatcgcgcgaggcgaagcggaagaagggggtgttgatagcgtttctagacggagggaggttattgttgacatcccagccgggaggtttagacctga |
30567251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 354 - 391
Target Start/End: Original strand, 30567298 - 30567334
Alignment:
| Q |
354 |
ctttgataaagaaaagtatataatattaatattaagat |
391 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30567298 |
ctttgataaa-aaaagtatataatattaatattaagat |
30567334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University