View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10399_6 (Length: 367)
Name: NF10399_6
Description: NF10399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10399_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 31 - 343
Target Start/End: Original strand, 6534009 - 6534324
Alignment:
| Q |
31 |
atttttggatacgtgatttgaagtattcatcacgaccttggttgtagaaatagtctaaacggtctttgtaaggttggatgaatgggatgccatagtcacc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6534009 |
atttttggatacgtgatttgaagtattcatcacgaccttggttgtagaaatagtctaaacggtctttgtatggttggatgaatgggatgccatagtcacc |
6534108 |
T |
|
| Q |
131 |
agggattttacggatcggaagtttggttgtttgtggttgagagatggagacttggaagggtggtatttctgaaactgaggatcttataggtggaagaaag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6534109 |
agggattttacggatcggaagtttggttgtttgtggttgagagatggagacttggaagggtggtttttctgaaactgaggatcttataggtggaagaaag |
6534208 |
T |
|
| Q |
231 |
gtggaggaacgtcgtgatgaggtggtggaagagggtctgttttggtgtttgaggagattagg---aggagttgaaagagtagaggaagccatgcttggag |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6534209 |
gtggaggaacgtcgtgatgaggtggtggaagagggtctgttttggtgtttgaggagattaggagaaggagttgaaagagtagaggaagccatgcttggag |
6534308 |
T |
|
| Q |
328 |
gtggtgaatggtgatg |
343 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6534309 |
gtggtgaatggtgatg |
6534324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University