View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10399_7 (Length: 362)
Name: NF10399_7
Description: NF10399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10399_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 251 - 331
Target Start/End: Original strand, 51054026 - 51054106
Alignment:
| Q |
251 |
tcactgatgactgaaaatccaaatgcgtttgcgccggaggtggcaaatacgacggtgtcggaggtcgtggaatggtttttg |
331 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51054026 |
tcactggtgactgaaaatccaaatgcatttgcgccggaggtggcaaatacgacggtgtcggaggtcgtggaatggtttttg |
51054106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 183 - 243
Target Start/End: Original strand, 13911024 - 13911084
Alignment:
| Q |
183 |
aaatcgaacattctcgattcgatttgcttcgttcttggaatcaccaatttgacacaggttc |
243 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13911024 |
aaatcgaatattctcgattcgatttgcttcgttcttggaatcaccaatttgacacaggttc |
13911084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University