View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1039_low_2 (Length: 284)
Name: NF1039_low_2
Description: NF1039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1039_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 39 - 121
Target Start/End: Original strand, 44525356 - 44525438
Alignment:
| Q |
39 |
gtgagatgaattatttgggtcccacttttttgcattatatcttgatccattttgtccttcatataagttccattcatcaagtt |
121 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||| |
|
|
| T |
44525356 |
gtgaaatgaattatttgggtcccacttttttgcattatatcttgatctattttgtccttcatataagttctattcaccaagtt |
44525438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 190 - 225
Target Start/End: Original strand, 44525506 - 44525541
Alignment:
| Q |
190 |
catctgaacaaaaaaccatgggtcaatccctatagt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44525506 |
catctgaacaaaaaaccatgggtcaatctctatagt |
44525541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University