View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1040-Insertion-3 (Length: 134)
Name: NF1040-Insertion-3
Description: NF1040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1040-Insertion-3 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 3e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 3e-64
Query Start/End: Original strand, 7 - 134
Target Start/End: Original strand, 19887915 - 19888042
Alignment:
| Q |
7 |
agttcttcgattttggcgactacgtcaatggagagatgcttggctaggatttcaggtgggagaccagacttggcaacaaggtgggaacatgttgtccaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19887915 |
agttcttcgattttggcgactacgtcaatggagagatgcttggctaggatttcaggtgggagaccagacttggcaacaaggtgggaacatgttgtccaaa |
19888014 |
T |
|
| Q |
107 |
gttgtggcatttcttgctttcttgaagc |
134 |
Q |
| |
|
|||| ||||||||||||||||||||||| |
|
|
| T |
19888015 |
gttggggcatttcttgctttcttgaagc |
19888042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University