View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1040-Insertion-5 (Length: 65)
Name: NF1040-Insertion-5
Description: NF1040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1040-Insertion-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 53; Significance: 3e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 8 - 64
Target Start/End: Complemental strand, 11030450 - 11030394
Alignment:
| Q |
8 |
ttttgtttaccatatattccggttctcatagtgccttcgaattttctctttgcatta |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11030450 |
ttttgtttaccatatattccggttctcatagtgccttcaaattttctctttgcatta |
11030394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University