View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10400_low_1 (Length: 299)

Name: NF10400_low_1
Description: NF10400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10400_low_1
NF10400_low_1
[»] chr3 (2 HSPs)
chr3 (117-289)||(43620539-43620710)
chr3 (16-48)||(43620445-43620477)


Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 117 - 289
Target Start/End: Original strand, 43620539 - 43620710
Alignment:
117 tcaaatgtattacaaattttggatctaacacatatgacctattggannnnnnnnngcatgtatatcgttttgggaatgccttgagtgaatatgtatgcaa 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||||    
43620539 tcaaatgtattacaaattttggatctaacacatatgacctattggatttttttt-gcatgtatatcgttttgggaatgccttgagtgaatatgtatgcaa 43620637  T
217 gagttacaagtttaaggccccaaatgaaaatgtaaagtcatgagcttctcattcactcagtggttgtcttcat 289  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43620638 gagttacaagtttcaggccccaaatgaaaatgtaaagtcatgagcttctcattcactcagtggttgtcttcat 43620710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 48
Target Start/End: Original strand, 43620445 - 43620477
Alignment:
16 atattttcatcataatattatgtattacaaatc 48  Q
    |||||||||||||||||||||||||||||||||    
43620445 atattttcatcataatattatgtattacaaatc 43620477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University