View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10400_low_1 (Length: 299)
Name: NF10400_low_1
Description: NF10400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10400_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 117 - 289
Target Start/End: Original strand, 43620539 - 43620710
Alignment:
| Q |
117 |
tcaaatgtattacaaattttggatctaacacatatgacctattggannnnnnnnngcatgtatatcgttttgggaatgccttgagtgaatatgtatgcaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43620539 |
tcaaatgtattacaaattttggatctaacacatatgacctattggatttttttt-gcatgtatatcgttttgggaatgccttgagtgaatatgtatgcaa |
43620637 |
T |
|
| Q |
217 |
gagttacaagtttaaggccccaaatgaaaatgtaaagtcatgagcttctcattcactcagtggttgtcttcat |
289 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43620638 |
gagttacaagtttcaggccccaaatgaaaatgtaaagtcatgagcttctcattcactcagtggttgtcttcat |
43620710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 48
Target Start/End: Original strand, 43620445 - 43620477
Alignment:
| Q |
16 |
atattttcatcataatattatgtattacaaatc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43620445 |
atattttcatcataatattatgtattacaaatc |
43620477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University