View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10400_low_2 (Length: 260)
Name: NF10400_low_2
Description: NF10400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10400_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 23 - 257
Target Start/End: Complemental strand, 39354442 - 39354209
Alignment:
| Q |
23 |
aaatatactattttttgtgtttattttgcccgttcttatttcttcccatcctccccgcgttttcattcctcactttttaaaaagaggcgggtgagatatt |
122 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39354442 |
aaatatactattttc-gtgtttattttgcccattcttatttcttcccatcctccccgcgttttcattcctcactttctaaaaagaggcgggtgagatatt |
39354344 |
T |
|
| Q |
123 |
taatgatacacctctgtttggtcaatcttacccaactttaaactgattggcctgtttttccatctctagtcacatctgtgtccttcaattgtggctcaag |
222 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39354343 |
taatactacacctctatttggtcaatcttaccccattttaaactgattggcctgtttttccatctctagtcacatctgtgtccttcaattgtggctcaag |
39354244 |
T |
|
| Q |
223 |
tgattgaaattgagtagactattacttttcccacc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39354243 |
tgattgaaattgagtagactattacttttcccacc |
39354209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University