View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10400_low_3 (Length: 254)
Name: NF10400_low_3
Description: NF10400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10400_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 6971520 - 6971269
Alignment:
| Q |
1 |
ctctctccctctctatggggccatatttataagcactaatataaaaaacatcattctaatataaagtttaggtgagttggattttcagggctcgtcaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
6971520 |
ctctctccctctctatggggccatatttataagcactaatataaaaaatatcattctaatataaagtttaggtgagttggattttcaggactcatcaaaa |
6971421 |
T |
|
| Q |
101 |
ttagagctgacctcaagatttaaagactgtttatagagatttttactgatcacccaccaaatattaatatataattgtatctatagggcgttagtaaata |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6971420 |
tcagagctgacctcaagatttaaagactgtttatagaggtttttactaatcacccaccaaatattaatatataattgtatctatagggcgttagtaaata |
6971321 |
T |
|
| Q |
201 |
aatttatcctccacacaactctctctacaagtctcccttgattcttctctct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6971320 |
aatttatcctccacacaactctctctacaagtctcccttgattcttctctct |
6971269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University