View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10401_low_2 (Length: 257)
Name: NF10401_low_2
Description: NF10401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10401_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 37863428 - 37863669
Alignment:
| Q |
1 |
gtacctagcattaatttgccaccattttcttctcatccttgttattgtcgtcgacggcattagctgtggaatgaaaggcgaaaatgttgttggagaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37863428 |
gtacctagcattaatttgccaccattttcttctcatccttgttattgtcgtcgacggcattagctgtggaatgaaaggcgaaaatgttgttggagaagga |
37863527 |
T |
|
| Q |
101 |
agccggattttttagggtgacataggctttcttataatctggttttgcgactaagctgcgattcttggacggttttcctttaacgttcaacgttcgaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37863528 |
agccggattttttagggtgacataggctttcttataatctggttttgcgactaagctgcgattcttggacggttttcctttaacgttcaacgttcgaact |
37863627 |
T |
|
| Q |
201 |
tttttaacttccaactgatagaaggattcgacgacatgtttg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37863628 |
tttttaacttccaactgatagaaggattcgacgacatgtttg |
37863669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University