View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10404_4 (Length: 302)
Name: NF10404_4
Description: NF10404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10404_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 33675150 - 33675440
Alignment:
| Q |
1 |
atagttctattcatattcctgcttcattgccagtaagtaaaatcggcccaatacaattgtgaaaattgtttatcttgcactgttgctgcagagcctgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33675150 |
atagttctattcatattcctgcttcattgccagtaagtaaaatcggcccaatacaattgtgaaaattgtttatcttgcactgttgctgcagagcctgttt |
33675249 |
T |
|
| Q |
101 |
ggtttaggtcttagatgtgttctgaatattcaaaaccgcattggaggaaaaattaatagcttgaatttttacattaacagtctttgggttatatgcctca |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33675250 |
ggtttaggtcttagatgtgttctggatattcaaaaccgcattggaggaaaaattaatagcttgaatttttacattaacagtctttgggttatatgcctca |
33675349 |
T |
|
| Q |
201 |
tggaaaataattgtccaagaatatccaaagttcttttgcttttctaagaccagtcaattcttacatacataataaatttgattctattcat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33675350 |
tggaaaataattgtccaagaatatccaaagttcttttgcttttctaagaccagtcaattcttacatacataataaatttgattctattcat |
33675440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University