View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10405_low_3 (Length: 230)
Name: NF10405_low_3
Description: NF10405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10405_low_3 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 36288752 - 36288523
Alignment:
| Q |
1 |
aataaccacttctccaccttcttttctctccttccataatcactatctgcggcgatgcttcagaatcaacactcattgtatagtttcctaatgaaggatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36288752 |
aataaccacttctccaccttcttttctctccttccataatcactatctgcggcgatgcttcagaatcaacactcattgtatagtttcctaatgaaggatc |
36288653 |
T |
 |
| Q |
101 |
attctccgatttccatgaacaaaaagttgcatccttcccaattccacttccaccgctcgccggagctttcatacctggaagatatgtatcagttggatct |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36288652 |
attctctgatttccatgaacaaaaagttgcatccttcccaattccatttccaccgctcaccggagctttcatacctggaagatatgtatcagttggatct |
36288553 |
T |
 |
| Q |
201 |
tcaaaactttgccaaatctctttgttattt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36288552 |
tcaaaactttgccaaatctctttgttattt |
36288523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 12096822 - 12097051
Alignment:
| Q |
1 |
aataaccacttctccaccttcttttctctccttccataatcactatctgcggcgatgcttcagaatcaacactcattgtatagtttcctaatgaaggatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12096822 |
aataaccacttctccaccttcttttctctccttccataatcactatatgtggtgatgcttcagaatcaacactcattgtatagtttccaaatgaaggatc |
12096921 |
T |
 |
| Q |
101 |
attctccgatttccatgaacaaaaagttgcatccttcccaattccacttccaccgctcgccggagctttcatacctggaagatatgtatcagttggatct |
200 |
Q |
| |
|
| ||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12096922 |
ttcctctgatttccatgaacaaaaagtagcatccttcccaattccacttccaccactcgccgaaactttcatacctggaagatatgtatcagttggatct |
12097021 |
T |
 |
| Q |
201 |
tcaaaactttgccaaatctctttgttattt |
230 |
Q |
| |
|
||||| |||||||||||||||||||||||| |
|
|
| T |
12097022 |
tcaaagctttgccaaatctctttgttattt |
12097051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 216
Target Start/End: Complemental strand, 21933250 - 21933201
Alignment:
| Q |
167 |
tttcatacctggaagatatgtatcagttggatcttcaaaactttgccaaa |
216 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| | ||||||||||||||| |
|
|
| T |
21933250 |
tttcatacctggaagaaatgtatctgttggatttgcaaaactttgccaaa |
21933201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University