View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10407_low_4 (Length: 237)
Name: NF10407_low_4
Description: NF10407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10407_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 6971762 - 6971982
Alignment:
| Q |
1 |
ccaacgtcaccttttttcccctgcattcatgggagaaaaacttaaggtattgaaaaatcgaggaaaatgtattcggtgcaattaggatatccctgcactc |
100 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||| ||||| |
|
|
| T |
6971762 |
ccaacgtcacattgtttcccctgcattcatgggagaaaaacttaaggtattgaaaaatcgaggaaaacgtattcggtgcaattggggtatccctacactc |
6971861 |
T |
 |
| Q |
101 |
acacagtcatgtattgccgattgttagatttacatcaaacatttcaaaaatacgtagattttattttattttcgaaaatttaatataccaagtttaaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6971862 |
acacagtcatgtattgccgattgttagatttacatcaaacatttcaaaaatacgtagattttattttattttcgaaaatttgatataccaagtttaaaat |
6971961 |
T |
 |
| Q |
201 |
tataattgttcaatattgatc |
221 |
Q |
| |
|
|| ||||||| ||||||||| |
|
|
| T |
6971962 |
taaaattgttacatattgatc |
6971982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University