View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10409_low_11 (Length: 250)
Name: NF10409_low_11
Description: NF10409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10409_low_11 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 14 - 250
Target Start/End: Complemental strand, 28754985 - 28754749
Alignment:
| Q |
14 |
aggaccgtgccaagtgcacataactgattggttgttgtgttttggaaaaggagagtagggacatcaacttcgggcgaggtttgctcccctccatgatccc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28754985 |
aggaccgtgccaagtgcacataactgattggttgttgtgttttggaaaaggagagtagggacatcaacttcgggcgaggtttgctcccctccatgatccc |
28754886 |
T |
|
| Q |
114 |
ataattagaacatattagttccattccatgctctcttttccacaccaaccttgtaacaattattctatttgttgaatgagtctttgttttgttcaatttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28754885 |
ataattagaacatattagttccattccatgctctcttttccacaccaaccttgtaacaattattctatttgttgaatgagtctttgttttgttcaatttt |
28754786 |
T |
|
| Q |
214 |
ttactacttgttcatttctatgatcttggttctatgc |
250 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28754785 |
ttactacttgttaatttctatgatcttggttctatgc |
28754749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University