View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1040R-Insertion-8 (Length: 178)
Name: NF1040R-Insertion-8
Description: NF1040R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1040R-Insertion-8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 11 - 178
Target Start/End: Complemental strand, 25839969 - 25839802
Alignment:
| Q |
11 |
cacgacttaagtgcctcctcttgatcaaaactatcacaattcaaacatgcaccaaaatttttaccacgaattttatttatgtgtaacatagtgatcaata |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25839969 |
cacgacttaagtgcctcctcttgatcaaaactatcagaattcaaacatgcaccaaaatttttaccacgaattttatttatgtgtaacatagtgatcaata |
25839870 |
T |
|
| Q |
111 |
aactcaatttgaatccatatcaacaacaaacatatgtttcaaccttttaccaagattatagtatagtc |
178 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25839869 |
aactcaatttgaatccaaatcaacaacaaacatatgtttcaaccttttaccaatattatagtatagtc |
25839802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University