View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1040_low_3 (Length: 251)
Name: NF1040_low_3
Description: NF1040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1040_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 26304724 - 26304890
Alignment:
| Q |
1 |
tatcaagcttctcatgattcttctcactcaagcaaccttcttttccattcgctaaaagcttctcttcttcaactttaaaagaagaatcatcgtcagtcac |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26304724 |
tatcaagcttgtcatgattcttctcactcaagcaaccttcttttccattccctaaaagcttctcttcttcaactttaaaagaagaatcatcgtcagtcac |
26304823 |
T |
 |
| Q |
101 |
cgatgacctatccgagctgaaaaccaatgaatcctgacttatttctgatgacacatgatttagatca |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26304824 |
cgatgacctatccgagctgaaaaccaatgaatcctgacttatttctgatgacacatgatttagatca |
26304890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 114 - 163
Target Start/End: Complemental strand, 12133885 - 12133836
Alignment:
| Q |
114 |
gagctgaaaaccaatgaatcctgacttatttctgatgacacatgatttag |
163 |
Q |
| |
|
||||| ||||| ||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
12133885 |
gagctaaaaacaaatgaatcctggcagatttctgatgacacatgatttag |
12133836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University