View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1040_low_4 (Length: 251)
Name: NF1040_low_4
Description: NF1040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1040_low_4 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 10 - 251
Target Start/End: Complemental strand, 19149271 - 19149030
Alignment:
| Q |
10 |
ccacagacccacattctggaacagataagctttcgataacaacatttcaggatattctattaaaaataattcaatgcgtgcagcaaaaattacagaatac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19149271 |
ccacagacccacattctggaacagataagctttcgataacaacatttcagtatattctattaaaaataattcaatgcgtgcagcaacaattacagaatac |
19149172 |
T |
|
| Q |
110 |
gtaggaataagaaagggaaagacaaggtggtgacgtatttaccctttgcgcaaatatgcctttgatagagaaggattcaactcaattgctttgtttgcat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19149171 |
gtaggaataagaaagggaaagacaaggtggtgacgtatttaccctttgcgcaaatatgcctttgatagagaaggattcaactcaattgctttgtttgcat |
19149072 |
T |
|
| Q |
210 |
cagcaacagcatctgaacaaaagtcaagaaattgccaaaatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19149071 |
cagcaacagcatctgaacaaaagtcaagaaattgccaaaatt |
19149030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University