View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10411_low_5 (Length: 367)
Name: NF10411_low_5
Description: NF10411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10411_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 43307677 - 43307986
Alignment:
| Q |
1 |
cccaataataaaatgaatcaactttcaccaattattgctatgatgtgtatttttaaaaaactagcggatctaattggtgtggt-----tgttatattatt |
95 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| || ||||||||| |
|
|
| T |
43307677 |
cccaataacaaaattaatcaactttcaccaattattgctatgatgtgtatttttaaaaatctagcggatctaattggtatggtatggttgatatattatt |
43307776 |
T |
|
| Q |
96 |
gtcttaaattgtaattatcgagtggtgattcaggcagcctacttgctacaatataatagcatttaaggtgtttaactgctcgtaaatcaaatgcttttgc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43307777 |
gtcttaaattgtaattatcgagtggtgattcaggcagcctacttgctacaatataatagcatttaaggtgtttaactgctcgtaaatcaaatgcttttgc |
43307876 |
T |
|
| Q |
196 |
tcttcagacttgctgagatttttctctgaagctggtctagtaagctctagtacatttttattatattg---acttgtatgtatcaaacattaatttgtct |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43307877 |
tcttcagacttgctgagatttttctctgaagctggtctagtaagctctagtacatttttattatattgaccacttgtatgtatcaaacattaatttgtct |
43307976 |
T |
|
| Q |
293 |
ctaatcattt |
302 |
Q |
| |
|
|||||||||| |
|
|
| T |
43307977 |
ctaatcattt |
43307986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 11 - 92
Target Start/End: Original strand, 33744112 - 33744193
Alignment:
| Q |
11 |
aaatgaatcaactttcaccaattattgctatgatgtgtatttttaaaaaactagcggatctaattggtgtggttgttatatt |
92 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||| |
|
|
| T |
33744112 |
aaattaatcaactttcaccaattattgctatgatgtgtatttttaaaaatctagcggatctaattggtatggttgatatatt |
33744193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University