View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10418_low_3 (Length: 534)
Name: NF10418_low_3
Description: NF10418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10418_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 15 - 94
Target Start/End: Original strand, 14396333 - 14396411
Alignment:
| Q |
15 |
acatcattaagatggagcttcagactaacagatagatgtcttgccacaatgnnnnnnntggaatttggagagtaaatcag |
94 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14396333 |
acatgattaagatggagcttcagactaacagatagatgtcttgccacaatg-aaaaaatggaatttggagagtaaatcag |
14396411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University