View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10418_low_8 (Length: 320)
Name: NF10418_low_8
Description: NF10418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10418_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 15 - 169
Target Start/End: Original strand, 31983921 - 31984075
Alignment:
| Q |
15 |
aaaaggaggatgaaaacttgctaagtaaatatgaaaaatgaaaattatttacttagaaagaatcaagaatcttaaatatgataaagacatttgattagtt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31983921 |
aaaaggaggatgaaaacttgctaagtaaatacgaaaaaagaaaattatttacttagaaagaatcaagaatcttaaatatgacaaagacatttgattagtt |
31984020 |
T |
 |
| Q |
115 |
gatataggtggttgaggtgagtgtattgtattaccttcaattcattcactcactc |
169 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
31984021 |
gatataggtggctgaggtgagtgtattgtgttaccttcaattcactcactcactc |
31984075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 254 - 314
Target Start/End: Original strand, 31984117 - 31984177
Alignment:
| Q |
254 |
gattgagaagagttttgaggtcaagcaaagtgagtttggcgtcacattcatttcatctcac |
314 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31984117 |
gattgagaagagttttggggtcaagcaaagtgagtttggcgtcacattcatttcatttcac |
31984177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University