View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10419_high_12 (Length: 269)
Name: NF10419_high_12
Description: NF10419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10419_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 43602626 - 43602875
Alignment:
| Q |
1 |
aagcgagtgcaattctagcaggaagaccaaagaattgggaagattttgctatgatatcgagcacacaaactctctatcagcagctacaagatcaagtaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43602626 |
aagcgagtgcaattctagcaggaagaccaaagaattgggaagattttgctatgaaatcgagcacacaaactctctatcagcaactacaagatcaagtaaa |
43602725 |
T |
 |
| Q |
101 |
tttagatggaaaatgttgtggatgaagctcaagaaagagaagaagaagctacttgagtctacatcatcacctttgcagcaggatccttatgatcctttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602726 |
tttagatggaaaatgttgtggatgaagctcaagaaagagaagaagaagctacttgagtctacatcatcacctttgcagcaggatccttatgatcctttca |
43602825 |
T |
 |
| Q |
201 |
cttattctcagaattttgaacaagggacagtgtttgatgaaccagattac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602826 |
cttattctcagaattttgaacaagggacagtgtttgatgaaccagattac |
43602875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University