View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10419_high_13 (Length: 268)
Name: NF10419_high_13
Description: NF10419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10419_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 20 - 255
Target Start/End: Original strand, 37771242 - 37771495
Alignment:
| Q |
20 |
ataaggacattggttaacataaataataaattatatagtctaaaataaataacaagacatttaatgattcaatgtcaggtaccagtaattggattgggtc |
119 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37771242 |
ataaggacattggttagcataaataaaaaattatatagtctaaaataaataacaagatatttaatgattcaatgtcaggtaccagtaattggattgggtc |
37771341 |
T |
|
| Q |
120 |
cggctcttcgaggagttgttatctttttctttgacttgttccttggctgt-------------------gttttgttgtattttatcttctctattttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
37771342 |
cggctcttcgaggagttgttatctttttctttgacttgttccttggctgtgtttttagttgatgctgtagttttgttgta-tttatcttctctattttct |
37771440 |
T |
|
| Q |
201 |
tggagtaccttcgatacactgagcctggcggcgtgtgtttgccctcaatacctct |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37771441 |
tggagtaccttcgatacactgagcctggcggcgtgtgtttgccctcaatatctct |
37771495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University