View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10419_low_13 (Length: 382)
Name: NF10419_low_13
Description: NF10419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10419_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 21 - 372
Target Start/End: Original strand, 37169057 - 37169408
Alignment:
| Q |
21 |
cattcatcacccgcaccaccagaaacctccctcatccataatccaactttctatttccaacacccattctggtctcaaaccaatttctgttatgtcattg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37169057 |
cattcatcacccgcaccaccagaaacctccctcatccataatccaactttccatttccaacacccattctgatctcaaaccaatttctgttatgtcattg |
37169156 |
T |
|
| Q |
121 |
tatctacagtggtcctgtcaaaacgtgccacttgtgcggccatgcacgaatagacatagttgatcacgcctgggaagcaaacagtggaagaagatgctac |
220 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37169157 |
tatctacagtgatcctgtcaaaacgtgccacttgtgcggccatgcacgaatagacatagttgatcacgcctgggaagcaaacagtggaagaagatgctac |
37169256 |
T |
|
| Q |
221 |
ataatactcgaacctgtggagttattgagcttttctttgcaaacataagtccatgtgttaaataatttcaatgtatggtcatcctccataatcctgcacc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37169257 |
ataatactcgaacctgtggagttattgagcttttctttgcaaacataagtccatgtgttaaataatttcaatgtattgtcatcctccataatcctgcacc |
37169356 |
T |
|
| Q |
321 |
tcacgcttcatcctatcctttcnnnnnnnccctataattatttgatgtccat |
372 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37169357 |
tcacgcttcatcctatcctttcattttttccctataattatttgatgtccat |
37169408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University