View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10419_low_18 (Length: 269)

Name: NF10419_low_18
Description: NF10419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10419_low_18
NF10419_low_18
[»] chr8 (1 HSPs)
chr8 (1-250)||(43602626-43602875)


Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 43602626 - 43602875
Alignment:
1 aagcgagtgcaattctagcaggaagaccaaagaattgggaagattttgctatgatatcgagcacacaaactctctatcagcagctacaagatcaagtaaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||    
43602626 aagcgagtgcaattctagcaggaagaccaaagaattgggaagattttgctatgaaatcgagcacacaaactctctatcagcaactacaagatcaagtaaa 43602725  T
101 tttagatggaaaatgttgtggatgaagctcaagaaagagaagaagaagctacttgagtctacatcatcacctttgcagcaggatccttatgatcctttca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43602726 tttagatggaaaatgttgtggatgaagctcaagaaagagaagaagaagctacttgagtctacatcatcacctttgcagcaggatccttatgatcctttca 43602825  T
201 cttattctcagaattttgaacaagggacagtgtttgatgaaccagattac 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
43602826 cttattctcagaattttgaacaagggacagtgtttgatgaaccagattac 43602875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University