View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10419_low_30 (Length: 233)
Name: NF10419_low_30
Description: NF10419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10419_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 30786759 - 30786973
Alignment:
| Q |
1 |
cttataaaatgtgcacattctttgtttagaatggagttttaatttctgacattgcttaaacatctagtgtttttggaagcagagtgctaattattgattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30786759 |
cttataaaatgtgcacattctttgtttagaatggagttttaatttctgacattgcttaaacatctagtgtttttggaagcagagtgctaattattgattt |
30786858 |
T |
|
| Q |
101 |
ttctaccgatattttcctaactaattgatgttcccacagtggacaagcatattctttgcatcaagataaattatgctactagttaaaaagaccaagtgcc |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30786859 |
ttctactgatattttcctaactaattgatgttcccacagtggacaagcatattctttgcatcaagataaattatgctactagttaaaaagaccaagtgcc |
30786958 |
T |
|
| Q |
201 |
atcaaaggttgcttt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
30786959 |
atcaaaggttgcttt |
30786973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University