View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10419_low_33 (Length: 213)
Name: NF10419_low_33
Description: NF10419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10419_low_33 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 35563160 - 35562949
Alignment:
| Q |
1 |
atgatacggtaacgagtactctagagatgcatagttcttctctttatgactaattaaggactctggctctaactcctctaagagccatcccatgtttgag |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35563160 |
atgatacggtaacgagtactctaaagatgcatagttcttctctttatgactaattaaggactctggctctaactcctctaagagccatcccatgtttgag |
35563061 |
T |
|
| Q |
101 |
tatgagaactgaggtgggcagaatgcaaccatgatgtggatttcttacaattaaactgttaacttaattattggcttagagatcattaagactatgtggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35563060 |
tatgagaactgaggtgggcagaatgcaaccatgatgtggatttcttacaatt-aactgttaacttaattattggcttagagatcattaagactatgtggt |
35562962 |
T |
|
| Q |
201 |
atatatagtatac |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35562961 |
atatatagtatac |
35562949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University