View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10419_low_5 (Length: 447)
Name: NF10419_low_5
Description: NF10419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10419_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 421; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 421; E-Value: 0
Query Start/End: Original strand, 15 - 439
Target Start/End: Original strand, 9379576 - 9380000
Alignment:
| Q |
15 |
aaatggaggaagaaacaaatgtgaggctgaggtgaaaccaagtccttcaatggaaagatcagaacatgtacttgatgttctatcagatgatgacacaagc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379576 |
aaatggaggaagaaacaaatgtgaggctgaggtgaaaccaagtccttcaatggaaagatcagaacatgtacttgatgttctatcagatgatgacacaagc |
9379675 |
T |
|
| Q |
115 |
ataaaagttgaatactttggtttagaagatgaaactggtcttatgaattttgctgaacatgctgatggttctttaacatcaccagaagattggagtgctt |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379676 |
ataaaggttgaatactttggtttagaagatgaaactggtcttatgaattttgctgaacatgctgatggttctttaacatcaccagaagattggagtgctt |
9379775 |
T |
|
| Q |
215 |
ttgaatcaaatgatttattaggccaatcaagttgtgattatcaatggtgggacttttggtcttgaatgaaacagaggaggaaaatatgtgtggaggaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379776 |
ttgaatcaaatgatttattaggccaatcaagttgtgattatcaatggtgggacttttggtcttgaatgaaacagaggaggaaaatatgtgtggaggaaat |
9379875 |
T |
|
| Q |
315 |
atatgcaaaatttatgatgttagaatcatcattgttttgttgaagaagttgtcagaggaaaatcaagggacattttgttttttgtacaacataatcatta |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379876 |
atatgcaaaatttatgatgttagaatcatcattgttttgttgaagaagttgtcagaggaaaatcaagggacattttgttttttgtacaacataatcatta |
9379975 |
T |
|
| Q |
415 |
gtttgtaggaaatgattttcatctc |
439 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9379976 |
gtttgtaggaaatgattttcatctc |
9380000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University