View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1041_high_9 (Length: 242)
Name: NF1041_high_9
Description: NF1041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1041_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 59 - 239
Target Start/End: Original strand, 46916981 - 46917159
Alignment:
| Q |
59 |
ggaagttttggttgtactgaagcacatgcacatggagtgatctgtgcaagg-ttggttcttctctgctctagacgacnnnnnnnnnnnnnnnnnnnnnca |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||| || |
|
|
| T |
46916981 |
ggaagttttggttgtactgaagcacatgcacatggagtgatctgtgcaagggttggttcttctctgctct--aagactagtagagtagtagtagtagtca |
46917078 |
T |
 |
| Q |
158 |
ctcattcattcatgtcatgtcatcaacctttacaagaatctctgactatgtcgtcgtcagcctattcttcatcttcattttc |
239 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | | | |||||||||||||||||| |
|
|
| T |
46917079 |
ctcattcattcat-tcatgtcatcaacctttacaagaatctctgactatgtcgtcagcctcttcttcttcatcttcattttc |
46917159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University