View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10420_low_7 (Length: 248)
Name: NF10420_low_7
Description: NF10420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10420_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 35127921 - 35128167
Alignment:
| Q |
1 |
aaacggctgctagtaattcttctccgcctcgagccaaatggagaaaagtagcatatggcggtatgcaacctggatatgatgacaatcataccgatgaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35127921 |
aaacggctgctagtaattcttctccgcctcgagccaaatggagaaaagtagcatatggcggtatgcaacctggatatgatgacaatcataccgatgaaac |
35128020 |
T |
|
| Q |
101 |
cttccttgaaggaatggtcatgaatgctagcgttgtaaaaaggaacatgctaaaggtgatgctggatgcagtttctatttctgaatatttatgcattgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35128021 |
cttccttgaaggaatggtcatgaatgctagcgttgtaaaaaggaacatgctaaaggtgatgctggacgcagtttctatttctgaatatttatgcattgtt |
35128120 |
T |
|
| Q |
201 |
gctcttgttgtcttggtctggacttgcacactttcatc-tctctcga |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35128121 |
gctcttgttgtcttggtctggacttgcacactttcatcatctctcga |
35128167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University