View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10420_low_9 (Length: 226)
Name: NF10420_low_9
Description: NF10420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10420_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 3849158 - 3849373
Alignment:
| Q |
18 |
tgttcaacaaccatatgagacaattgggaacatagtacacaaacacatgatcataaaatattgcattgaaacgtgtgagtgttgcttttgtggtgaaaat |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3849158 |
tgttcaacaaccatatgagacagttgggaacatagtacacaaacacatgatcataaaatattgcattgaaacgtgtgagtgttgcttttgtggtgaaaat |
3849257 |
T |
|
| Q |
118 |
cttttaccaaatagtttgttgactgttttattttaaac--------------------taaaacatagttttgatgacttttatacgagttgaactttca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3849258 |
cttttaccaaatagtttgttgactgttttattttaaactaaattatggttccgttaaataaaacatagttttgatgacttttatacgagttgaactttca |
3849357 |
T |
|
| Q |
198 |
tatacgtaccctatgc |
213 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3849358 |
tatacgtaccctatgc |
3849373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University