View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10420_low_9 (Length: 226)

Name: NF10420_low_9
Description: NF10420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10420_low_9
NF10420_low_9
[»] chr1 (1 HSPs)
chr1 (18-213)||(3849158-3849373)


Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 3849158 - 3849373
Alignment:
18 tgttcaacaaccatatgagacaattgggaacatagtacacaaacacatgatcataaaatattgcattgaaacgtgtgagtgttgcttttgtggtgaaaat 117  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3849158 tgttcaacaaccatatgagacagttgggaacatagtacacaaacacatgatcataaaatattgcattgaaacgtgtgagtgttgcttttgtggtgaaaat 3849257  T
118 cttttaccaaatagtttgttgactgttttattttaaac--------------------taaaacatagttttgatgacttttatacgagttgaactttca 197  Q
    ||||||||||||||||||||||||||||||||||||||                    ||||||||||||||||||||||||||||||||||||||||||    
3849258 cttttaccaaatagtttgttgactgttttattttaaactaaattatggttccgttaaataaaacatagttttgatgacttttatacgagttgaactttca 3849357  T
198 tatacgtaccctatgc 213  Q
    ||||||||||||||||    
3849358 tatacgtaccctatgc 3849373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University