View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10421_low_12 (Length: 226)
Name: NF10421_low_12
Description: NF10421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10421_low_12 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 4866430 - 4866641
Alignment:
| Q |
1 |
tcttaaaaacttaaatatacaattgtatccatacttatacttatacttatacttatatctatttgtagttgcatgaagatgtttcttgaactattgtatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4866430 |
tcttaaaaacttaaatatacaattgtatccatacttatacttat--------------ctatttgtagttgcatgtagatgtttcttgaactattgtatt |
4866515 |
T |
|
| Q |
101 |
ttttgcagatgcacaatctataagagtatttttagacgttgggctttagtactttaatgtcttggttcatgaaccaaaagatctaaatgtatttcatttc |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4866516 |
ttttgcacatgcacaatctataagagtatttttagacgttgggctttagtactttaatgtcttggttcatgaaccaaaagatctaaatctatttcatttc |
4866615 |
T |
|
| Q |
201 |
acatcattaacctttttagtctccct |
226 |
Q |
| |
|
| |||||||||||||||||||||||| |
|
|
| T |
4866616 |
atatcattaacctttttagtctccct |
4866641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University