View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10421_low_9 (Length: 251)
Name: NF10421_low_9
Description: NF10421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10421_low_9 |
 | |
|
| [»] scaffold0321 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0321 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: scaffold0321
Description:
Target: scaffold0321; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 235
Target Start/End: Original strand, 16381 - 16604
Alignment:
| Q |
11 |
cataggcatatgcatttttcatacacatgtatttttaactagacattatcatgtgatcttccacgtcctatatctgtactgctcttcaacaatcatttat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16381 |
cataggcatatgcatttttcatacacatgtatttttaactagacattatcatgtgatctttcacgtcctatatttgtactgctcttcaacaatcatttat |
16480 |
T |
|
| Q |
111 |
tatcttgatggtttttcgaaccatctctttatatatttatagatattaatcatggttgcggtcacaaaaatttatataagcatttttgtattaaatacat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16481 |
ctacttgatggtttttcgaaccatctctttatatatttatagatattaatcatggttgcggtcacaaaaatttatataagca-ttttgtattaaatacat |
16579 |
T |
|
| Q |
211 |
ttattgagtataatttatctatata |
235 |
Q |
| |
|
|||||||||| ||||||||| |||| |
|
|
| T |
16580 |
ttattgagtagaatttatctctata |
16604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University