View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10422_high_15 (Length: 296)
Name: NF10422_high_15
Description: NF10422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10422_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 75 - 293
Target Start/End: Complemental strand, 36524190 - 36523972
Alignment:
| Q |
75 |
aaaatgcttcatgagatactcgatattgttctggttggagctttgttcttgaatgaattgatcgatttggttgcaggcacgatcaagctcgttactcata |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36524190 |
aaaatgcttcatgagatactcgatattgttctggttggagctttgttcttgaatgaattgatcgatttggttgcaggcacgatcaagctcgttactcata |
36524091 |
T |
 |
| Q |
175 |
gccaagatgaggggcatgcttctcaacgaatgcttctcttcaacaacaatttgacttaacacctttagaagcttcttcgatgtagatatactgtttttag |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36524090 |
gccaagatgaggggcatgcttctcaacgaatgcttctcttcaacaacaatttgacttaacacctttagaagcttcttcgatgtagatatactgcttttag |
36523991 |
T |
 |
| Q |
275 |
cttccttaagacggttctt |
293 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36523990 |
cttccttaagacggttctt |
36523972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University