View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10422_low_22 (Length: 297)
Name: NF10422_low_22
Description: NF10422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10422_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 30769138 - 30769324
Alignment:
| Q |
18 |
tgtttgattgttttctcacaggttttgattaggaagacacacactaca----gctttggttgttgtttcttgtctttggctcattcctttcatatgcagc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769138 |
tgtttgattgttttctcacaggttttgattaggaagacacacactacactttgctttggttgttgtttcttgtctttggctcattcctttcatatgcagc |
30769237 |
T |
 |
| Q |
114 |
tgttgaattgtgacaattccatcactactgtttgctggtcccaaaaagccaaaacctgccattgcaatctttcagattccttttatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769238 |
tgttgaattgtgacaattccatcactactgtttgctggtcccaaaaagccaaaacctgccattgcaatctttcagattccttttatc |
30769324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University