View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10422_low_29 (Length: 228)
Name: NF10422_low_29
Description: NF10422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10422_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 9 - 214
Target Start/End: Complemental strand, 6001046 - 6000842
Alignment:
| Q |
9 |
agtagcataggacaataggaccaaaccgactagcaaaagatacagtggagaaagatgaggaaagtgagaggaatctcattctcccgcaaatgtgatttcc |
108 |
Q |
| |
|
|||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6001046 |
agtaacataagacaataggagcaaaccgactagcaaaagatacagtggagaaagatgaggaaagtgagaggaatctcattctcccgcaaatgtgatttcc |
6000947 |
T |
|
| Q |
109 |
ccgattnnnnnnnttcaacagattaaacaccaattattctttgtattatcgaaacacccactcctacattttttgaaacatagtgacaccgccttacata |
208 |
Q |
| |
|
|||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6000946 |
ccga-taaaaaaattcaacagatcaaacaccaattattctttgtattatcgaaacacccactcctatattttttgaaacatagtgacaccgccttacata |
6000848 |
T |
|
| Q |
209 |
ttcatg |
214 |
Q |
| |
|
|||||| |
|
|
| T |
6000847 |
ttcatg |
6000842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University