View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10422_low_31 (Length: 225)
Name: NF10422_low_31
Description: NF10422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10422_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 208
Target Start/End: Original strand, 29093977 - 29094171
Alignment:
| Q |
15 |
aaggcaatttatttctttcccttgtctcttaatctctcccaccaaaacgagttgatcttctatgattttcctcccccaaatttagagaagaaagaagg-t |
113 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29093977 |
aaggcaatttatttattttccttgtctcttaatctctcccaccaaaacgagttgatcttctatgattttcctcccccaaatttagagaagaaagaagggt |
29094076 |
T |
|
| Q |
114 |
actcataaaaaatgtagggatggattgcgctactaacttaatcagaactcatgtgcatgcctttgacaagtttcatgaccattaattcttgtatt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29094077 |
actcataaaaaatgtagggatggattgcgctactgacttaatcagaactcatgtgcatgcctttgacaagtttcatgaccattaattcttgtatt |
29094171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University