View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10422_low_32 (Length: 221)
Name: NF10422_low_32
Description: NF10422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10422_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 48343003 - 48343206
Alignment:
| Q |
1 |
agcggacctcaagtttttgtgccatagaaaaatttgtgttaagaagtgttttgtgtgtatatatgtatatataaagatccttaaaacaaaatgtatatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48343003 |
agcggacctcaagtttttgtgccatagaaaaatttgtgttaagaagtgttttgtgtgtatatatgtatatataaagatccttaaaacaatatgtatatat |
48343102 |
T |
|
| Q |
101 |
aaagattattttagtctttagaagctctcgatcatcgaagtaaatacaatgtgatagcgaagcatatcactcaatggtgcgtttgtattgtaagttgtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48343103 |
aaagattattttagtctttagaagctctcgatcatcgaagtaaatacaatgtgatagcgaagcatatcactcaatggtgcgtttgtattgtaagttgtaa |
48343202 |
T |
|
| Q |
201 |
ctat |
204 |
Q |
| |
|
|||| |
|
|
| T |
48343203 |
ctat |
48343206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University