View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10422_low_33 (Length: 213)
Name: NF10422_low_33
Description: NF10422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10422_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 46525972 - 46526160
Alignment:
| Q |
18 |
atgaaagcaggccccacaccatacccc-ccacaaataataaacaatagcagcactgcacgagctgaatttctctcgtgcacaacatctttgcctcactta |
116 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46525972 |
atgaaatcaggccccacaccatacccccccacaaataataaacaatagcagcactgcacgagctgaatttctctcgtgcacaacatctttgcctcactta |
46526071 |
T |
|
| Q |
117 |
ttataatttatatactgtatatgtgtgtgt----------gagagagagagcgagctcatgcaactatgaaattatttctcaaggaaaa |
195 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46526072 |
ttataatttatataatgtatatgtgtgtgtgagagagagagagagagagagcgagctcatggaactatgaaattatttctcaaggaaaa |
46526160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University