View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10422_low_5 (Length: 540)
Name: NF10422_low_5
Description: NF10422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10422_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 186 - 525
Target Start/End: Original strand, 21298585 - 21298926
Alignment:
| Q |
186 |
tgagatagtccatatgtttaaggtagcacataggagtagcaaagcaaggtaggaaggtagatatccgaggataagtgattgtgcggaacgggaagtttgc |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21298585 |
tgagatagtccatatgtttaaggtagcacatgggagtagcaaagcaaggtaggaaggtagatatccgaggataagtgattgtgcggaacgggaagtttgc |
21298684 |
T |
|
| Q |
286 |
agcggtattgaaaatcaaagtttcaatttgaacatcatctcgtgatctagagagggtggtggcatttttacgagcttcaaaacgagttcgcttaagagaa |
385 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21298685 |
agcggtattgaaaatcaaagtttcaatttcaacatcatctcgtgatctagagagggtggtgacatttttacgagcttcaaaacgagttcgcttaagagaa |
21298784 |
T |
|
| Q |
386 |
gcagtagctttgtctttttccatttgggcattggattctttaatcaggtctctagcagttgcacaacaaagacaattggatcaacagggtctggaattgt |
485 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21298785 |
gcagtagctttgtctttttccatttgggcattggattctttaatcaggtctctagcagttgcacaacaaagacaattggtccaacagggtctggaattgt |
21298884 |
T |
|
| Q |
486 |
gcatcagtg--tatgttgtttgcatatttttcatctgctttt |
525 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21298885 |
gcatcagtgacagtgttgtttgcatatttttcatctgctttt |
21298926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 21298458 - 21298589
Alignment:
| Q |
1 |
atccttcagggagtattgggtctgaaaatcattgagcaaagtcaggatttcagaaccgggggacagcaaacgagcgcattccatagcacgaaaggtctgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21298458 |
atccttcagggagtattgggtctgaaaatcattgagcaaagtcaggatttcagaaccgggggacagcaaaccagcgcattccatagcacgaaaggtctgg |
21298557 |
T |
|
| Q |
101 |
atgtagaacagaataccgacataaatttgaga |
132 |
Q |
| |
|
||||||||||||||||| | |||||||||||| |
|
|
| T |
21298558 |
atgtagaacagaataccaaaataaatttgaga |
21298589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University