View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10424_low_10 (Length: 244)
Name: NF10424_low_10
Description: NF10424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10424_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 24 - 232
Target Start/End: Original strand, 52784795 - 52785003
Alignment:
| Q |
24 |
gaaactaatacggctgtccctccaaactcgcaagtgccaccagaagctttcgtcctttgccagtaactattgaaggcataggaagcatgtgcaaatacac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52784795 |
gaaactaatacggctgtccctccaaactcgcaagtgccaccagaagctttcgtcctttgccagtaactattgaaggcataggaagcatgtgcaaatacac |
52784894 |
T |
 |
| Q |
124 |
tgtcgggctgaaagcaaggcccgttcggctgaatcgaactgcagtctgctcctgaccaacaggcataattcatggcctcttcgatgattggatctggaac |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52784895 |
tgtcgggctgaaagcaaggcccgttcggctgaatcgaactgcagtctgctcctgaccaacaggcataattcatggcctcttcgatgattggatctggaac |
52784994 |
T |
 |
| Q |
224 |
tgatgcctt |
232 |
Q |
| |
|
||||||||| |
|
|
| T |
52784995 |
tgatgcctt |
52785003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University