View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10424_low_3 (Length: 412)
Name: NF10424_low_3
Description: NF10424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10424_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 133 - 402
Target Start/End: Original strand, 12321622 - 12321891
Alignment:
| Q |
133 |
tccctctcttatgctgaagatgagtagcgccaatgccctatgaggccaagacctctcatcctcgtaagaggcagtggtagaactaacatatgaatgcgca |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12321622 |
tccctctcttatgctgaagatgagtagcgccaatgccctatgaggccaagacctctcatcctcgtaagaggcagtggtagaactaacatatgaatgcgca |
12321721 |
T |
|
| Q |
233 |
tttgaccacttttgattctggaaaacaaggacggctcaacactcctagtaggcacagtccctcactgaaatggagcaaggatggctcaacactccttgca |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12321722 |
tttgaccacttttgattctggaaaacaaggacgactcaacactcctagtaggcacagtccctcactgaaatggagcaaggatggctcaacactccttgca |
12321821 |
T |
|
| Q |
333 |
ggcactacccctcgctaaaatggagcgttaaagaaaatgaagactgaaattccctccgaaaatccctatg |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12321822 |
ggcactacccctcgctaaaatggagcgttaaagaaaatgaaaactgaaattccctccgaaaatccctatg |
12321891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 19 - 135
Target Start/End: Original strand, 12321455 - 12321571
Alignment:
| Q |
19 |
acgcagattatggtttcccaacatcttattatacggagtcattctttccgacatcatattattcgaaccggatcatcatttccggcatcggcttattcag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12321455 |
acgcagattatggtttcccaacatcttattatacggagtcattctttccgacatcatattattcgaaccggatcatcatttccggcatcggattattcag |
12321554 |
T |
|
| Q |
119 |
accggattatcttttcc |
135 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
12321555 |
accggattatcttttcc |
12321571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University