View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10424_low_7 (Length: 310)
Name: NF10424_low_7
Description: NF10424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10424_low_7 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 181 - 310
Target Start/End: Complemental strand, 6032802 - 6032673
Alignment:
| Q |
181 |
taattttatgttttgaaacagtgaaacaattatcaaataaagaaaaacactagttacctgatgatagattcattcttgatattgcagaaaagttggatct |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032802 |
taattttatgttttgaaacagtgaaacaattatcaaataaagaaaaacactagttacctgatgatagattcattcttgatattgcagaaaagttggatct |
6032703 |
T |
|
| Q |
281 |
tccagtggcagcatcattgttattattatt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6032702 |
tccagtggcagcatcattgttattattatt |
6032673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 18 - 118
Target Start/End: Complemental strand, 6032971 - 6032871
Alignment:
| Q |
18 |
aattcattcttatgatctcagaatatgctgaaaaatatcagctaatatcgatttggactggtattgcaatcctcccatgattttccaaagatttgaagcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032971 |
aattcattcttatgatctcagaatatgctgaaaaatatcagctaatatcgatttggactggtattgcaatcctcccatgattttccaaagatttgaagcc |
6032872 |
T |
|
| Q |
118 |
c |
118 |
Q |
| |
|
| |
|
|
| T |
6032871 |
c |
6032871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 82 - 118
Target Start/End: Complemental strand, 6713012 - 6712976
Alignment:
| Q |
82 |
tgcaatcctcccatgattttccaaagatttgaagccc |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
6713012 |
tgcattcctcccatgattttccaaagatttggagccc |
6712976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University