View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10425_low_1 (Length: 217)

Name: NF10425_low_1
Description: NF10425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10425_low_1
NF10425_low_1
[»] chr8 (1 HSPs)
chr8 (12-199)||(9422184-9422371)


Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 12 - 199
Target Start/End: Complemental strand, 9422371 - 9422184
Alignment:
12 agcagagacagagctatggagaatctctttagcaacatctggattgcaagtaactatggctcttgtgtcaccaagactaaaagccatgagtcttgttgct 111  Q
    |||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
9422371 agcaaagacagagctatggagaatttctttagcaacatctggattgcaagtaaccatggctcttgtgtcaccaagactaaaagccatgagtcttgttgct 9422272  T
112 ttgcatgtttttgctgtggaagctatacggtggtgtgctagtgatgaagacataagattcatgcttccaaatagaggatacccttttg 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9422271 ttgcatgtttttgctgtggaagctatacggtggtgtgctagtgatgaagacataagattcatgcttccaaatagaggatacccttttg 9422184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University