View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10425_low_2 (Length: 205)
Name: NF10425_low_2
Description: NF10425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10425_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 22 - 196
Target Start/End: Original strand, 37938044 - 37938216
Alignment:
| Q |
22 |
gatgatgcttcagttatacaactatctttgcaagatgacacgaaaataaaacaggnnnnnnnnnnnnatttttcattagtttcaaaagcataattaccaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
37938044 |
gatgatgcttcagttatacaactatctttgcaagatgacacgaaaataaaacaggtatatatata--atttttcattagttccaaaagcataattaccaa |
37938141 |
T |
|
| Q |
122 |
tattgatattgttgcttatctattctnnnnnnntgagtattcctttaatgacaaattttcacatctctgcttctc |
196 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37938142 |
tattgatattgttgcttatctattctaaaaaaatgagtattcctttaatgacaaattttcacatctctacttctc |
37938216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University