View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10426_high_12 (Length: 236)

Name: NF10426_high_12
Description: NF10426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10426_high_12
NF10426_high_12
[»] chr6 (1 HSPs)
chr6 (10-220)||(10309614-10309824)


Alignment Details
Target: chr6 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 10 - 220
Target Start/End: Original strand, 10309614 - 10309824
Alignment:
10 aatagatagattaggttcacgaatataaaatcataaatttttatcctaaccgaaccattttaatgtttgtcnnnnnnnttcatatttgatccgaactaaa 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||    
10309614 aatagatagattaggttcacgaatataaaatcataaatttttatcctaaccgaaccattttaatgtttgtcaaaaaaattcatatttgatccgaactaaa 10309713  T
110 actaaaaagttgaagttaattgttctattcacccctcaagtatgtttctcaaccctgaaaaataaaccgattgggagttacatcctggtaaagaaacaaa 209  Q
    ||||||||||||||||||| ||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
10309714 actaaaaagttgaagttaactgttctatctacccctcaagtatgtttctcaaccctgaaaaataaaccgattgggagttacatcctggtaaagaaacaac 10309813  T
210 gatcagataat 220  Q
    |||||||||||    
10309814 gatcagataat 10309824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University